pCMV6-AN-DDK_WT POLH_ΔGG Ubiquitin
(Plasmid
#221861)
-
PurposeExpresses FLAG-tagged WT POLH fused to ΔGG ubiquitin in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 221861 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV6-AN-DDK
- Total vector size (bp) 8282
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePOLH
-
Alt nameDNA polymerase eta
-
SpeciesH. sapiens (human)
-
MutationCoding sequence has been optimised for expression in human cells
-
Entrez GenePOLH (a.k.a. RAD30, RAD30A, XP-V, XPV)
- Promoter CMV
-
Tags
/ Fusion Proteins
- ΔGG Ubiquitin (C terminal on insert)
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AsiSI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is a variant of pCMV6-AN-DDK_WT POLH (Addgene #221897) with ΔGG ubiquitin fused to the C-terminus of POLH.
Please visit https://doi.org/10.1101/2024.10.12.618026 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV6-AN-DDK_WT POLH_ΔGG Ubiquitin was a gift from Roger Woodgate (Addgene plasmid # 221861 ; http://n2t.net/addgene:221861 ; RRID:Addgene_221861) -
For your References section:
Human DNA polymerase eta is regulated by mutually exclusive mono-ubiquitination and mono-NEDDylation. Moreno NC, Korchak EJ, Latancia MT, D'Orlando DA, Adegbenro T, Barnes RP, Bezsonova I, Woodgate R, Ashton NW. Nucleic Acids Res. 2026 Feb 5;54(4):gkag098. doi: 10.1093/nar/gkag098. 10.1093/nar/gkag098 PubMed 41693564