Skip to main content

pCMV6-AN-DDK_K682A POLH
(Plasmid #221862)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 221862 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV6-AN-DDK
  • Total vector size (bp) 8060
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    POLH
  • Alt name
    DNA polymerase eta
  • Species
    H. sapiens (human)
  • Mutation
    POLH K682A. Coding sequence has been optimised for expression in human cells
  • Entrez Gene
    POLH (a.k.a. RAD30, RAD30A, XP-V, XPV)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AsiSI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is a variant of pCMV6-AN-DDK_WT POLH (Addgene #221897) with POLH mutation K682A.

Please visit https://doi.org/10.1101/2024.10.12.618026 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV6-AN-DDK_K682A POLH was a gift from Roger Woodgate (Addgene plasmid # 221862 ; http://n2t.net/addgene:221862 ; RRID:Addgene_221862)
  • For your References section:

    Human DNA polymerase eta is regulated by mutually exclusive mono-ubiquitination and mono-NEDDylation. Moreno NC, Korchak EJ, Latancia MT, D'Orlando DA, Adegbenro T, Barnes RP, Bezsonova I, Woodgate R, Ashton NW. Nucleic Acids Res. 2026 Feb 5;54(4):gkag098. doi: 10.1093/nar/gkag098. 10.1093/nar/gkag098 PubMed 41693564