pCMV6-AN-DDK_K682A_K686A_K694A_K709A POLH
(Plasmid
#221865)
-
PurposeExpresses POLH mutated at K682A, K686A, K694A and K709A with a FLAG tag in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 221865 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV6-AN-DDK
- Total vector size (bp) 8060
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePOLH
-
Alt nameDNA polymerase eta
-
SpeciesH. sapiens (human)
-
MutationPOLH K682A, K686A, K694A + K709A. Coding sequence has been optimised for expression in human cells
-
Entrez GenePOLH (a.k.a. RAD30, RAD30A, XP-V, XPV)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AsiSI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is a variant of pCMV6-AN-DDK_WT POLH (Addgene #221897) with POLH mutations K682A, K686A, K694A + K709A. These mutations prevent POLH mono-ubiquitination and mono-NEDDylation.
Please visit https://doi.org/10.1101/2024.10.12.618026 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV6-AN-DDK_K682A_K686A_K694A_K709A POLH was a gift from Roger Woodgate (Addgene plasmid # 221865 ; http://n2t.net/addgene:221865 ; RRID:Addgene_221865) -
For your References section:
Human DNA polymerase eta is regulated by mutually exclusive mono-ubiquitination and mono-NEDDylation. Moreno NC, Korchak EJ, Latancia MT, D'Orlando DA, Adegbenro T, Barnes RP, Bezsonova I, Woodgate R, Ashton NW. Nucleic Acids Res. 2026 Feb 5;54(4):gkag098. doi: 10.1093/nar/gkag098. 10.1093/nar/gkag098 PubMed 41693564