Skip to main content
Addgene
Open Menu

pET-28b(+)_N-His_NEDD8
(Plasmid #221866)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 221866 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pET28b (+)
  • Total vector size (bp) 5564
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NEDD8
  • Species
    H. sapiens (human)
  • Mutation
    Codon optimised for expression in E. coli
  • Entrez Gene
    NEDD8 (a.k.a. NEDD-8)
  • Promoter T7
  • Tag / Fusion Protein
    • 6x His - thrombin cleavage site (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.10.12.618026 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-28b(+)_N-His_NEDD8 was a gift from Roger Woodgate (Addgene plasmid # 221866 ; http://n2t.net/addgene:221866 ; RRID:Addgene_221866)

  • For your References section:

    Human DNA polymerase eta is regulated by mutually exclusive mono-ubiquitination and mono-NEDDylation. Moreno NC, Korchak EJ, Latancia MT, D'Orlando DA, Adegbenro T, Barnes RP, Bezsonova I, Woodgate R, Ashton NW. Nucleic Acids Res. 2026 Feb 5;54(4):gkag098. doi: 10.1093/nar/gkag098. 10.1093/nar/gkag098 PubMed 41693564
Related items: