Skip to main content

pcDNA3.1(+)-N-DYK_K164R PCNA
(Plasmid #221874)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 221874 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1(+)-N-DYK
  • Total vector size (bp) 6230
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PCNA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    783
  • Mutation
    K164R
  • Entrez Gene
    PCNA (a.k.a. ATLD2)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Modification of pcDNA3.1(+)-N-DYK_WT PCNA (Addgene #221858) with PCNA mutation K164R.

Please visit https://doi.org/10.1101/2024.10.12.618026 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1(+)-N-DYK_K164R PCNA was a gift from Roger Woodgate (Addgene plasmid # 221874 ; http://n2t.net/addgene:221874 ; RRID:Addgene_221874)
  • For your References section:

    Human DNA polymerase eta is regulated by mutually exclusive mono-ubiquitination and mono-NEDDylation. Moreno NC, Korchak EJ, Latancia MT, D'Orlando DA, Adegbenro T, Barnes RP, Bezsonova I, Woodgate R, Ashton NW. Nucleic Acids Res. 2026 Feb 5;54(4):gkag098. doi: 10.1093/nar/gkag098. 10.1093/nar/gkag098 PubMed 41693564