Skip to main content
Addgene
Open Menu

pcDNA3.1(+)-N-DYK_K164R PCNA_ΔGG ubiquitin
(Plasmid #221875)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 221875 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1(+)-N-DYK
  • Total vector size (bp) 6452
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PCNA
  • Species
    H. sapiens (human)
  • Mutation
    K164R
  • Entrez Gene
    PCNA (a.k.a. ATLD2)
  • Promoter CMV
  • Tags / Fusion Proteins
    • Ubiquitin ΔGG (C terminal on insert)
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Modification of plasmid "pcDNA3.1(+)-N-DYK_K164R PCNA" (Addgene #221874), with the CDS of ubiquitin ΔGG fused to the C-terminus of PCNA.

Please visit https://doi.org/10.1101/2024.10.12.618026 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1(+)-N-DYK_K164R PCNA_ΔGG ubiquitin was a gift from Roger Woodgate (Addgene plasmid # 221875 ; http://n2t.net/addgene:221875 ; RRID:Addgene_221875)

  • For your References section:

    Human DNA polymerase eta is regulated by mutually exclusive mono-ubiquitination and mono-NEDDylation. Moreno NC, Korchak EJ, Latancia MT, D'Orlando DA, Adegbenro T, Barnes RP, Bezsonova I, Woodgate R, Ashton NW. Nucleic Acids Res. 2026 Feb 5;54(4):gkag098. doi: 10.1093/nar/gkag098. 10.1093/nar/gkag098 PubMed 41693564
Related items: