pGR721 - SLD3p-TP-DNAP1.Badboy2
(Plasmid
#222013)
-
PurposeExpresses the Badboy2 TP-DNAP1 variant under control of a weak promoter for reducing p1 copy number
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222013 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeYeast Expression
-
Selectable markersNourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTP-DNAP1 BadBoy2
- Promoter SLD3p
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATCCAGTTTTTAATCTGTCG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please see https://doi.org/10.1101/2023.11.13.566922 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGR721 - SLD3p-TP-DNAP1.Badboy2 was a gift from Chang Liu (Addgene plasmid # 222013 ; http://n2t.net/addgene:222013 ; RRID:Addgene_222013) -
For your References section:
Continuous evolution of user-defined genes at 1 million times the genomic mutation rate. Rix G, Williams RL, Hu VJ, Spinner A, Pisera AO, Marks DS, Liu CC. Science. 2024 Nov 8;386(6722):eadm9073. doi: 10.1126/science.adm9073. Epub 2024 Nov 8. 10.1126/science.adm9073 PubMed 39509492