pCAGGS-PHOSPHO1-TEV-Twin-Strep
(Plasmid
#222015)
-
PurposeExpress human PHOSPHO1 protein (C-terminal Tobacco Etch Virus (TEV) protease cleavable Twin-Strep-fusion protein (ENLYFQGS-WSHPQFEK-(GGGS)2-GGSA-WSHPQFEK)) in mammalian cell
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222015 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAGGS-N-TEV-Twin-Strep
-
Backbone manufacturerChiaki Murakami
- Backbone size w/o insert (bp) 4871
- Total vector size (bp) 5672
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePHOSPHO1
-
Alt namephosphoethanolamine/phosphocholine phosphatase 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)801
-
Mutationstop codon (TGA) is deleted
-
GenBank IDNM_178500.4
-
Entrez GenePHOSPHO1
-
Entrez GenePHOSPHO1
- Promoter chicken β-actin promoter
-
Tags
/ Fusion Proteins
- TEV cleavable site (C terminal on backbone)
- Twin-Strep-tag (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTCGGCTTCTGGCGTGTGACC
- 3′ sequencing primer TATTAGCCAGAAGTCAGATGCTCAAGG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The insert can be removed using the restriction enzyme, XhoI.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS-PHOSPHO1-TEV-Twin-Strep was a gift from Chiaki Murakami (Addgene plasmid # 222015 ; http://n2t.net/addgene:222015 ; RRID:Addgene_222015)