pACB112
(Plasmid
#222211)
-
PurposeFor recombinant expression of fghA (PP_1617 from Pseudomonas putida) with the S11R mutation and a C-terminal His tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222211 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET-21b(+)
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5542
- Total vector size (bp) 6211
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namefghA(S11R)
-
Alt namePP_1617
-
SpeciesPseudomonas putida KT2440
-
Insert Size (bp)852
-
MutationChanged Serine 11 to Arginine
-
GenBank IDAAN67238.1
- Promoter T7
-
Tag
/ Fusion Protein
- 6x His (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTwist Biosciences
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACB112 was a gift from Gregg Beckham (Addgene plasmid # 222211 ; http://n2t.net/addgene:222211 ; RRID:Addgene_222211) -
For your References section:
Evolution and engineering of pathways for aromatic O-demethylation in Pseudomonas putida KT2440. Bleem AC, Kuatsjah E, Johnsen J, Mohamed ET, Alexander WG, Kellermyer ZA, Carroll AL, Rossi R, Schlander IB, Peabody V GL, Guss AM, Feist AM, Beckham GT. Metab Eng. 2024 Jul;84:145-157. doi: 10.1016/j.ymben.2024.06.009. Epub 2024 Jun 25. 10.1016/j.ymben.2024.06.009 PubMed 38936762