pAF125
(Plasmid
#222373)
-
PurposeRecombinant human IgG antibody vector without variable regions. Contains mTagBFP marker.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222373 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAF111
-
Backbone manufacturerAndrew S. Flies Lab
-
Vector typeMammalian Expression, Affinity Reagent/ Antibody
-
Selectable markersHygromycin ; mTagBFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIGHG (partial)
-
SpeciesH. sapiens (human)
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcctcagacagtggttcaaag
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid generated by Gibson assembly using NotI and BsiWI sites.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAF125 was a gift from Andrew S. Flies (Addgene plasmid # 222373 ; http://n2t.net/addgene:222373 ; RRID:Addgene_222373) -
For your References section:
Conversion of Mouse-Derived Hybridomas to Tasmanian Devil Recombinant IgG Antibodies. Slyp B, Darby JM, Flies AS. Methods Mol Biol. 2024;2826:231-249. doi: 10.1007/978-1-0716-3950-4_17. 10.1007/978-1-0716-3950-4_17 PubMed 39017897