pLN34 - pBait-5GC[1xMS2]-McaS
(Plasmid
#222403)
-
Purposearabinose-induced synthesis of a hybrid RNA with an MS2 hairpin surrounded by a 5bp GC clamp with E coli McaS inserted between XmaI and HindIII sites. Insert can be replaced with RNA bait of interest.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222403 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDF
- Backbone size w/o insert (bp) 3892
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMcaS
-
SpeciesE. coli
-
Insert Size (bp)94
-
Entrez GenemcaS (a.k.a. b4426, ECK1336, IS061, isrA)
- Promoter pBAD
-
Tag
/ Fusion Protein
- 1xMS2 hairpin, 5GC clamp
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XmaI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CCGGTAACCCCGCTTATTAAAAGC
- 3′ sequencing primer TATCAGACCGCTTCTGCGTTC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLN34 - pBait-5GC[1xMS2]-McaS was a gift from Katherine Berry (Addgene plasmid # 222403 ; http://n2t.net/addgene:222403 ; RRID:Addgene_222403) -
For your References section:
Improved constructs for bait RNA display in a bacterial three-hybrid assay. Linh D. Nguyen , Hannah LeBlanc & Katherine E. Berry. Sci Rep 15, 3820 (2025) 10.1038/s41598-024-85082-9