pLN43 - pBait-1xMS2-7GC[chiP-5']-TtrpA
(Plasmid
#222404)
-
Purposearabinose-induced synthesis of a hybrid RNA containing a 5' MS2 hairpin, E. coli chiP 5'UTR insert between XmaI and HindIII sites, surrounded by a 7bp GC clamp, and followed by a 3' trpA terminator.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 222404 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCDF
- Backbone size w/o insert (bp) 3933
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name5’UTR of chiP (-98 to +12, relative to AUG)
-
SpeciesE. coli
-
Insert Size (bp)107
-
Entrez GenechiP (a.k.a. b0681, ECK0669, ybfM)
- Promoter pBAD
-
Tag
/ Fusion Protein
- 1xMS2 hairpin, 7GC clamp, TtrpA terminator
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XmaI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CCGGTAACCCCGCTTATTAAAAGC
- 3′ sequencing primer TATCAGACCGCTTCTGCGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLN43 - pBait-1xMS2-7GC[chiP-5']-TtrpA was a gift from Katherine Berry (Addgene plasmid # 222404 ; http://n2t.net/addgene:222404 ; RRID:Addgene_222404) -
For your References section:
Improved constructs for bait RNA display in a bacterial three-hybrid assay. Linh D. Nguyen , Hannah LeBlanc & Katherine E. Berry. Sci Rep 15, 3820 (2025) 10.1038/s41598-024-85082-9