Skip to main content

pLN43 - pBait-1xMS2-7GC[chiP-5']-TtrpA
(Plasmid #222404)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 222404 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCDF
  • Backbone size w/o insert (bp) 3933
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    5’UTR of chiP (-98 to +12, relative to AUG)
  • Species
    E. coli
  • Insert Size (bp)
    107
  • Entrez Gene
    chiP (a.k.a. b0681, ECK0669, ybfM)
  • Promoter pBAD
  • Tag / Fusion Protein
    • 1xMS2 hairpin, 7GC clamp, TtrpA terminator

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XmaI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CCGGTAACCCCGCTTATTAAAAGC
  • 3′ sequencing primer TATCAGACCGCTTCTGCGTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLN43 - pBait-1xMS2-7GC[chiP-5']-TtrpA was a gift from Katherine Berry (Addgene plasmid # 222404 ; http://n2t.net/addgene:222404 ; RRID:Addgene_222404)
  • For your References section:

    Improved constructs for bait RNA display in a bacterial three-hybrid assay. Linh D. Nguyen , Hannah LeBlanc & Katherine E. Berry. Sci Rep 15, 3820 (2025) 10.1038/s41598-024-85082-9