pMX-Sox17-p2A-Erg-t2A-GFP
(Plasmid
#222496)
-
Purposemouse fibroblast-to-endothelial cell direct reprogramming
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222496 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMX
- Backbone size w/o insert (bp) 4582
- Total vector size (bp) 8170
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameSox17
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1257
-
Entrez GeneSox17
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGCCGGATCTAGCTAGTTAATTAAATGAGCAGCCCGGATGCG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameErg
-
Insert Size (bp)1459
-
Entrez GeneErg (a.k.a. D030036I24Rik)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GCGCCACAAACTTCTCTCTGCTAAAGCAAGCAGGTGATGTTGAAGAAAACCCCGGGCCTACTAGTATGATCCAGACTGTACCTGA (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameEGFP
-
Insert Size (bp)720
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMX-Sox17-p2A-Erg-t2A-GFP was a gift from Li Qian (Addgene plasmid # 222496 ; http://n2t.net/addgene:222496 ; RRID:Addgene_222496) -
For your References section:
Direct conversion of cardiac fibroblasts into endothelial-like cells using Sox17 and Erg. Farber G, Dong Y, Wang Q, Rathod M, Wang H, Dixit M, Keepers B, Xie Y, Butz K, Polacheck WJ, Liu J, Qian L. Nat Commun. 2024 May 16;15(1):4170. doi: 10.1038/s41467-024-48354-6. 10.1038/s41467-024-48354-6 PubMed 38755186