TRE3GV-SpdCas9-Dnmt3A/3L-V2
(Plasmid
#222505)
-
PurposeExpresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V2 (E814G) and hPGK promoter driven mCherry
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 222505 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneLentiCRISPR v2
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V2 (E814G) engineered fusion
-
SpeciesM. musculus (mouse), Synthetic; Streptococcus pyogenes
-
Insert Size (bp)5829
-
MutationD10A and H840A in S.pyogenes Cas9; E814G in Dnmt3A
- Promoter TRE3GV
-
Tag
/ Fusion Protein
- FLAG Tag (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer accagtttactccctatcagtgata (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)708
- Promoter hPGK
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer caatagcggctgctcagcaggg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TRE3GV-SpdCas9-Dnmt3A/3L-V2 was a gift from Isaac Hilton (Addgene plasmid # 222505 ; http://n2t.net/addgene:222505 ; RRID:Addgene_222505) -
For your References section:
Characterization of Rationally Designed CRISPR/Cas9-Based DNA Methyltransferases with Distinct Methyltransferase and Gene Silencing Activities in Human Cell Lines and Primary Human T Cells. Guerra-Resendez RS, Lydon SL, Ma AJ, Bedford GC, Reed DR, Kim S, Teran ER, Nishiguchi T, Escobar M, DiNardo AR, Hilton IB. ACS Synth Biol. 2025 Feb 3. doi: 10.1021/acssynbio.4c00569. 10.1021/acssynbio.4c00569 PubMed 39898483