pX330_REC8_cterm
(Plasmid
#222522)
-
PurposeCas9/sgRNA plasmid for targeting REC8
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222522 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX330
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9, REC8 sgRNA
-
gRNA/shRNA sequenceCTCTAACCTCAGTGGAATCT
-
SpeciesH. sapiens (human), Synthetic
-
Entrez GeneREC8 (a.k.a. HR21spB, REC8L1, Rec8p)
Cloning Information
- Cloning method Golden Gate
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.05.31.596483 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330_REC8_cterm was a gift from George Church (Addgene plasmid # 222522 ; http://n2t.net/addgene:222522 ; RRID:Addgene_222522) -
For your References section:
Induction of Meiosis from Human Pluripotent Stem Cells. Pierson Smela M, Adams J, Ma C, Breimann L, Widocki U, Shioda T, Church GM. bioRxiv 2024.05.31.596483 10.1101/2024.05.31.596483