pUC57 mini-ZsGreen
(Plasmid
#222648)
-
PurposeVector for cloning gene of interest for in vitro transcription
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222648 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC57-mini
-
Backbone manufacturerGenScript
- Total vector size (bp) 2988
-
Vector typein vitro transcription
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZsGreen
-
SpeciesZoanthus sp.
-
Insert Size (bp)696
-
Mutationmutated stop codon
- Promoter T7
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This vector contains 5'UTR and 3'UTR of HBB gene.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC57 mini-ZsGreen was a gift from Silvia Monticelli (Addgene plasmid # 222648 ; http://n2t.net/addgene:222648 ; RRID:Addgene_222648) -
For your References section:
Crosstalk between Regnase-1 and -3 shapes mast cell survival and cytokine expression. Bataclan M, Leoni C, Moro SG, Pecoraro M, Wong EH, Heissmeyer V, Monticelli S. Life Sci Alliance. 2024 Jun 3;7(8):e202402784. doi: 10.26508/lsa.202402784. Print 2024 Aug. 10.26508/lsa.202402784 PubMed 38830770