pUC57 mini-ZsGreen-P2A-FLAG-HA-Regnase-1 WT
(Plasmid
#222649)
-
PurposeFor in vitro transcription of mouse Zc3h12a tagged with FLAG-HA at N-term
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222649 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC57-mini-ZsGreen-P2A
-
Backbone manufacturerGenScript
- Backbone size w/o insert (bp) 3070
- Total vector size (bp) 4861
-
Modifications to backboneremoved XhoI site upstream of P2A
-
Vector typein vitro transcription
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZc3h12a
-
Alt nameMcpip1, Reg-1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1791
-
Entrez GeneZc3h12a (a.k.a. MCPIP, MCPIP-1, Mcpip1, Reg1)
- Promoter T7
-
Tags
/ Fusion Proteins
- FLAG (N terminal on insert)
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byVigo Heissmeyer's lab (Behrens G, Edelmann SL, Raj T, Kronbeck N, Monecke T, Davydova E, Wong EH, Kifinger L, Giesert F, Kirmaier ME, et al. (2021) Disrupting Roquin-1 interaction with Regnase-1 induces autoimmunity and enhances antitumor responses. Nat Immunol 22: 1563–1576. doi:10.1038/s41590-021-01064-3)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC57 mini-ZsGreen-P2A-FLAG-HA-Regnase-1 WT was a gift from Silvia Monticelli (Addgene plasmid # 222649 ; http://n2t.net/addgene:222649 ; RRID:Addgene_222649) -
For your References section:
Crosstalk between Regnase-1 and -3 shapes mast cell survival and cytokine expression. Bataclan M, Leoni C, Moro SG, Pecoraro M, Wong EH, Heissmeyer V, Monticelli S. Life Sci Alliance. 2024 Jun 3;7(8):e202402784. doi: 10.26508/lsa.202402784. Print 2024 Aug. 10.26508/lsa.202402784 PubMed 38830770