pCDH-Regnase-3 WT-T2A-copGFP
(Plasmid
#222660)
-
PurposeLentiviral vector to express mouse Regnase-3 WT
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222660 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDH-EF1α-T2A-copGFP
-
Backbone manufacturerSystem Biosciences
- Backbone size w/o insert (bp) 7258
- Total vector size (bp) 9910
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZc3h12c
-
Alt nameMcpip3, Reg-3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2655
-
Mutationmutated stop codon prior to a T2A peptide
-
Entrez GeneZc3h12c (a.k.a. A230108E06, C230027N18Rik, mKIAA1726)
- Promoter EF1α
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ctccacgctttgcctgaccctgctt
- 3′ sequencing primer ggtgctcttcatcttgttggtcatgc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-Regnase-3 WT-T2A-copGFP was a gift from Silvia Monticelli (Addgene plasmid # 222660 ; http://n2t.net/addgene:222660 ; RRID:Addgene_222660) -
For your References section:
Crosstalk between Regnase-1 and -3 shapes mast cell survival and cytokine expression. Bataclan M, Leoni C, Moro SG, Pecoraro M, Wong EH, Heissmeyer V, Monticelli S. Life Sci Alliance. 2024 Jun 3;7(8):e202402784. doi: 10.26508/lsa.202402784. Print 2024 Aug. 10.26508/lsa.202402784 PubMed 38830770