pmiRGLO-Zc3h12a 3’UTR
(Plasmid
#222662)
-
PurposeLuciferase reporter vector containing mouse Zc3h12a 3'UTR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 222662 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepmirGLO Dual-Luciferase miRNA Target Expression Vector
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 7362
- Total vector size (bp) 8142
-
Modifications to backboneadded EcoRI and SmaI restriction enzyme sites in the multiple cloning site
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZc3h12a 3'UTR
-
Alt nameMcpip1, Reg-1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)786
-
Entrez GeneZc3h12a (a.k.a. MCPIP, MCPIP-1, Mcpip1, Reg1)
- Promoter PGK
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer AGAAGCTGCGCGGTGGTGTTGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
There is a single G nucleotide missing within the last 10 nucleotides of the Zc3h12a 3'UTR, which does not affect the functionality of the gene insert nor the plasmid itself.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmiRGLO-Zc3h12a 3’UTR was a gift from Silvia Monticelli (Addgene plasmid # 222662 ; http://n2t.net/addgene:222662 ; RRID:Addgene_222662) -
For your References section:
Crosstalk between Regnase-1 and -3 shapes mast cell survival and cytokine expression. Bataclan M, Leoni C, Moro SG, Pecoraro M, Wong EH, Heissmeyer V, Monticelli S. Life Sci Alliance. 2024 Jun 3;7(8):e202402784. doi: 10.26508/lsa.202402784. Print 2024 Aug. 10.26508/lsa.202402784 PubMed 38830770