pLKO.1 mTagBFP2 rat DJ-1 shRNA
(Plasmid
#222870)
-
PurposeExpresses mTagBFP2 along with an shRNA against rat DJ-1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222870 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.1 - TRC mTagBFP2
- Backbone size w/o insert (bp) 7073
- Total vector size (bp) 7135
-
Vector typeMammalian Expression, Lentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDJ-1 shRNA
-
Alt namepark7
-
gRNA/shRNA sequenceATCTGGGTGCACAGAACTTAT
-
SpeciesR. norvegicus (rat)
-
Entrez GenePark7 (a.k.a. CAP1, DJ-1, Dj1, SP22)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer U6 (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.10.10.561760 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1 mTagBFP2 rat DJ-1 shRNA was a gift from Timothy Ryan (Addgene plasmid # 222870 ; http://n2t.net/addgene:222870 ; RRID:Addgene_222870) -
For your References section:
Phosphoglycerate kinase is a central leverage point in Parkinson's disease-driven neuronal metabolic deficits. Kokotos AC, Antoniazzi AM, Unda SR, Ko MS, Park D, Eliezer D, Kaplitt MG, De Camilli P, Ryan TA. Sci Adv. 2024 Aug 23;10(34):eadn6016. doi: 10.1126/sciadv.adn6016. Epub 2024 Aug 21. 10.1126/sciadv.adn6016 PubMed 39167658