Skip to main content

pX330_TFAP2C_cterm
(Plasmid #222916)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 222916 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9, TFAP2C sgRNA
  • gRNA/shRNA sequence
    AATAAAATTGGAACGAAGAA
  • Species
    H. sapiens (human), Synthetic
  • Entrez Gene
    TFAP2C (a.k.a. AP2-GAMMA, ERF1, TFAP2G, hAP-2g)

Cloning Information

  • Cloning method Golden Gate

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2022.07.11.499564 for bioRxiv preprint

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330_TFAP2C_cterm was a gift from George Church (Addgene plasmid # 222916 ; http://n2t.net/addgene:222916 ; RRID:Addgene_222916)
  • For your References section:

    Rapid Human Oogonia-like Cell Specification via Combinatorial Transcription Factor-Directed Differentiation. Pierson Smela M, Kramme CC, Fortuna PRJ, Wolf B, Srikar Kavirayuni V, Adams J, Ma C, Velychko S, Widocki U, Goel S, Chen T, Vincoff S, Dong E, Kohman RE, Kobayashi M, Shioda T, Church GM, Chatterjee P. bioRxiv 2022.07.11.499564 10.1101/2022.07.11.499564