pX330_DAZL_cterm2
(Plasmid
#222919)
-
PurposeCas9/sgRNA plasmid for targeting DAZL
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222919 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX330
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9, DAZL sgRNA 2
-
gRNA/shRNA sequenceATGTAACTAGATAAGCCAGG
-
SpeciesH. sapiens (human), Synthetic
-
Entrez GeneDAZL (a.k.a. DAZH, DAZL1, DAZLA, SPGYLA)
Cloning Information
- Cloning method Golden Gate
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.07.11.499564 for bioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330_DAZL_cterm2 was a gift from George Church (Addgene plasmid # 222919 ; http://n2t.net/addgene:222919 ; RRID:Addgene_222919) -
For your References section:
Rapid Human Oogonia-like Cell Specification via Combinatorial Transcription Factor-Directed Differentiation. Pierson Smela M, Kramme CC, Fortuna PRJ, Wolf B, Srikar Kavirayuni V, Adams J, Ma C, Velychko S, Widocki U, Goel S, Chen T, Vincoff S, Dong E, Kohman RE, Kobayashi M, Shioda T, Church GM, Chatterjee P. bioRxiv 2022.07.11.499564 10.1101/2022.07.11.499564