pOSV00170
(Plasmid
#222934)
-
PurposeConstitutive GFP expression for Bacillus subtilis
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222934 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneColE1
-
Vector typeBacterial Expression, Synthetic Biology
-
Selectable markersChloramphenicol resistance gene for Bacillus subtilis genomic integration at ycgO locus
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP(Sp)
- Promoter Phyperspank
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGTTGAACTAATGGGTGCTTTAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe GFP(Sp) was cloned by Overkamp W and Veening JW et al. and the GFP(Sp) plasmid was purchased from Bacillus Genetic Stock Center (ECE278).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOSV00170 was a gift from Ophelia Venturelli (Addgene plasmid # 222934 ; http://n2t.net/addgene:222934 ; RRID:Addgene_222934) -
For your References section:
Programming bacteria for multiplexed DNA detection. Cheng YY, Chen Z, Cao X, Ross TD, Falbel TG, Burton BM, Venturelli OS. Nat Commun. 2023 Apr 10;14(1):2001. doi: 10.1038/s41467-023-37582-x. 10.1038/s41467-023-37582-x PubMed 37037805