Skip to main content

pLentiCRISPRv1-49535-sgFmr1_CGG5-2
(Plasmid #222964)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 222964 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiCRISPR
  • Backbone manufacturer
    Feng Zhang (Addgene #49535)
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FMR1 sgRNA
  • gRNA/shRNA sequence
    CCAGGGGGCGTGCGGCAGCG
  • Species
    H. sapiens (human)
  • Entrez Gene
    FMR1 (a.k.a. FMRP, FRAXA, POF, POF1)

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPRv1-49535-sgFmr1_CGG5-2 was a gift from Xinyu Zhao (Addgene plasmid # 222964 ; http://n2t.net/addgene:222964 ; RRID:Addgene_222964)
  • For your References section:

    CGG repeats in the human FMR1 gene regulate mRNA localization and cellular stress in developing neurons. Sirois CL, Guo Y, Li M, Wolkoff NE, Korabelnikov T, Sandoval S, Lee J, Shen M, Contractor A, Sousa AMM, Bhattacharyya A, Zhao X. Cell Rep. 2024 Jun 11;43(6):114330. doi: 10.1016/j.celrep.2024.114330. 10.1016/j.celrep.2024.114330 PubMed 38865241