His-CL7-2NLS-SpyCas9(dS)-A22p3star
(Plasmid
#222970)
-
PurposeBacterial expression of A22p-fused SpyCas9 construct
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222970 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCold
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsThe Doudna lab uses BL21 Rosetta E. coli for protein expression.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHis-CL7-2NLS-SpyCas9(dS)-A22p3
-
Alt name2x-Cas9(dS)-A22p3
-
SpeciesSynthetic
-
Insert Size (bp)4881
- Promoter tac
-
Tags
/ Fusion Proteins
- His (N terminal on insert)
- CL7 (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer agcggataacaatttgatgtgc
- 3′ sequencing primer ATAATACCGCGCCACATAGC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
His-CL7-2NLS-SpyCas9(dS)-A22p3star was a gift from Jennifer Doudna (Addgene plasmid # 222970 ; http://n2t.net/addgene:222970 ; RRID:Addgene_222970) -
For your References section:
Engineering self-deliverable ribonucleoproteins for genome editing in the brain. Chen K, Stahl EC, Kang MH, Xu B, Allen R, Trinidad M, Doudna JA. Nat Commun. 2024 Feb 26;15(1):1727. doi: 10.1038/s41467-024-45998-2. 10.1038/s41467-024-45998-2 PubMed 38409124