His-CL7_MBP_1xNLS_iGeoCas9(C1)_2xNLS(star)
(Plasmid
#222990)
-
PurposeBacterial expression of iGeoCas9(C1) construct
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222990 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCold
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsThe Doudna lab uses BL21 Rosetta E. coli for protein expression.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHis-CL7_MBP_1xNLS_iGeoCas9(C1)_2xNLS(star)
-
Alt name1x-iGeoCas9(R1-GRK)-2x
-
SpeciesSynthetic
-
Insert Size (bp)4992
- Promoter tac
-
Tags
/ Fusion Proteins
- His (N terminal on insert)
- CL7 (N terminal on insert)
- MBP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer agcggataacaatttgatgtgc
- 3′ sequencing primer ATAATACCGCGCCACATAGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
His-CL7_MBP_1xNLS_iGeoCas9(C1)_2xNLS(star) was a gift from Jennifer Doudna (Addgene plasmid # 222990 ; http://n2t.net/addgene:222990 ; RRID:Addgene_222990) -
For your References section:
Lung and liver editing by lipid nanoparticle delivery of a stable CRISPR-Cas9 RNP. Chen K, Han H, Zhao S, Xu B, Yin B, Trinidad M, Burgstone BW, Murthy N, Doudna JA. bioRxiv [Preprint]. 2023 Nov 15:2023.11.15.566339. doi: 10.1101/2023.11.15.566339. 10.1101/2023.11.15.566339 PubMed 38014175