pMB26
(Plasmid
#223009)
-
PurposeCas12a and Csy4 with 5' target (I) for Nicotiana leaf assay
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 223009 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLIIIβ F A-B - BB53
-
Backbone manufacturerBinder et al., 2014
-
Vector typePlant Expression, CRISPR
-
Selectable markersFirefly luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas12a and Csy4 with 5' target (I)
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer GGTGGCAGGATATATTGTGGTG
- 3′ sequencing primer CGCTCTTTTCTCTTAGGTTTACCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byHolger Puchta (sequence of tt_At_LbCas12a).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMB26 was a gift from Martin Parniske (Addgene plasmid # 223009 ; http://n2t.net/addgene:223009 ; RRID:Addgene_223009) -
For your References section:
A quantitative assay for the efficiency of RNA-guided genome editing in plants. Bircheneder M, Schreiber T, Tissier A, Parniske M. Plant J. 2024 Sep;119(5):2564-2577. doi: 10.1111/tpj.16931. Epub 2024 Jul 20. 10.1111/tpj.16931 PubMed 39032106