pIND4-RC-M210TAG-A7
(Plasmid
#223015)
-
PurposeExpresses 3 subunits of photosynthetic reaction center from R. sphaeroides and aaRS-tRNA pair for 3-nitrotyrosine
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 223015 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepIND4
- Backbone size w/o insert (bp) 9235
- Total vector size (bp) 13162
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namepuhA
-
SpeciesRhodobacter sphaeroides
-
Insert Size (bp)800
-
Tag
/ Fusion Protein
- 6xHis (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer AATAGGCGTATCACGAGGCC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namepufL
-
SpeciesRhodobacter sphaeroides
-
Insert Size (bp)849
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site None (unknown if destroyed)
- 5′ sequencing primer TGGGTGTCGAACACGGGCTAC
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namepufM
-
SpeciesRhodobacter sphaeroides
-
Insert Size (bp)927
-
Mutationchanged Tyr M210 to amber stop codon (TAG) for amber suppression
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site None (unknown if destroyed)
- 3′ cloning site NdeI (unknown if destroyed)
- 5′ sequencing primer GCTGAAGGAAGGCGGGCTG
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameA7 RS
-
SpeciesMethanosarcina barkeri
-
Insert Size (bp)1263
- Promoter rrnB
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer CCGCTTCTTTGAGCGAACGATC
- (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert namepylT tRNA
-
SpeciesMethanosarcina barkeri
-
Insert Size (bp)88
- Promoter rrnB
Cloning Information for Gene/Insert 5
- Cloning method Gibson Cloning
- 5′ sequencing primer CATCAGCCCTgAGGTCGGGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIND4-RC-M210TAG-A7 was a gift from Steven Boxer (Addgene plasmid # 223015 ; http://n2t.net/addgene:223015 ; RRID:Addgene_223015)