Skip to main content

pMB105
(Plasmid #223016)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223016 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    LIIIβ F A-B - BB53
  • Backbone manufacturer
    Binder et al., 2014
  • Vector type
    Plant Expression, CRISPR
  • Selectable markers
    Firefly luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9 and Csy4 with 5' and 3' targets (I)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GGTGGCAGGATATATTGTGGTG
  • 3′ sequencing primer CGCTCTTTTCTCTTAGGTTTACCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Yiping Qi's lab. Sequence of At_Cas9 was derived from plasmid pYPQ154 (Addgene plasmid #69305), Reference: Lowder, L.G., Zhang, D., Baltes, N.J., Paul, J.W., Tang, X., Zheng, X., Voytas, D.F., Hsieh, T.-F., Zhang, Y., and Qi, Y. (2015). A CRISPR/Cas9 toolbox for multiplexed plant genome editing and transcriptional regulation. Plant Physiol 169 (2): 971–985.

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMB105 was a gift from Martin Parniske (Addgene plasmid # 223016 ; http://n2t.net/addgene:223016 ; RRID:Addgene_223016)
  • For your References section:

    A quantitative assay for the efficiency of RNA-guided genome editing in plants. Bircheneder M, Schreiber T, Tissier A, Parniske M. Plant J. 2024 Sep;119(5):2564-2577. doi: 10.1111/tpj.16931. Epub 2024 Jul 20. 10.1111/tpj.16931 PubMed 39032106