pMB105
(Plasmid
#223016)
-
PurposeCas9 and Csy4 with 5' and 3' targets (I) for Nicotiana leaf assay
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 223016 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLIIIβ F A-B - BB53
-
Backbone manufacturerBinder et al., 2014
-
Vector typePlant Expression, CRISPR
-
Selectable markersFirefly luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9 and Csy4 with 5' and 3' targets (I)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GGTGGCAGGATATATTGTGGTG
- 3′ sequencing primer CGCTCTTTTCTCTTAGGTTTACCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byYiping Qi's lab. Sequence of At_Cas9 was derived from plasmid pYPQ154 (Addgene plasmid #69305), Reference: Lowder, L.G., Zhang, D., Baltes, N.J., Paul, J.W., Tang, X., Zheng, X., Voytas, D.F., Hsieh, T.-F., Zhang, Y., and Qi, Y. (2015). A CRISPR/Cas9 toolbox for multiplexed plant genome editing and transcriptional regulation. Plant Physiol 169 (2): 971–985.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMB105 was a gift from Martin Parniske (Addgene plasmid # 223016 ; http://n2t.net/addgene:223016 ; RRID:Addgene_223016) -
For your References section:
A quantitative assay for the efficiency of RNA-guided genome editing in plants. Bircheneder M, Schreiber T, Tissier A, Parniske M. Plant J. 2024 Sep;119(5):2564-2577. doi: 10.1111/tpj.16931. Epub 2024 Jul 20. 10.1111/tpj.16931 PubMed 39032106