rag2:TSPAN31_CE_pISceI
(Plasmid
#223025)
-
PurposeExpress TSPAN31 gene in mesenchymal lineage of Zebrafish.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 223025 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneRag2 plasmid
- Backbone size w/o insert (bp) 12500
-
Vector typeExpress the insert(gene) in mesenchymal lineage of Zebrafish.
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTSPAN31
-
SpeciesH. sapiens (human)
-
Insert Size (bp)630
-
Entrez GeneTSPAN31 (a.k.a. SAS)
- Promoter Rag2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHi (unknown if destroyed)
- 3′ cloning site Clai (unknown if destroyed)
- 5′ sequencing primer CTGTGGTAAAGCCATGGTTG
- 3′ sequencing primer GCCCTAGTGAGAGCCGTACC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
rag2:TSPAN31_CE_pISceI was a gift from Alejandro Gutierrez (Addgene plasmid # 223025 ; http://n2t.net/addgene:223025 ; RRID:Addgene_223025) -
For your References section:
A methyltransferase-independent role for METTL1 in tRNA aminoacylation and oncogenic transformation. Ali RH, Orellana EA, Lee SH, Chae YC, Chen Y, Clauwaert J, Kennedy AL, Gutierrez AE, Papke DJ, Valenzuela M, Silverman B, Falzetta A, Ficarro SB, Marto JA, Fletcher CDM, Perez-Atayde A, Alcindor T, Shimamura A, Prensner JR, Gregory RI, Gutierrez A. Mol Cell. 2025 Mar 6;85(5):948-961.e11. doi: 10.1016/j.molcel.2025.01.003. Epub 2025 Jan 31. 10.1016/j.molcel.2025.01.003 PubMed 39892392