pACYC-T7-SpCas9(BspMI/SapI/BsaI_cassettes)-T7-gRNA1 (BPK1807)
(Plasmid
#223065)
-
PurposeDual pT7 entry plasmid for SpCas9(6AA) library; bacterial expression plasmid with type IIS RE cassettes around D1135/S1136, G1218/E1219, R1335/T1337 (precursor to MMW94). Expresses a gRNA.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 223065 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepACYC-T7-SpCas9-T7-gRNA1 (BPK848)
-
Backbone manufacturerBenjamin Kleinstiver, Addgene plasmid #181745
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameentry vector for human codon opt. bacterial expr. plasmid for SpCas9(6AA_NNS) library, with gRNA targeting EGFP site 1
-
Alt nameBPK1807
-
gRNA/shRNA sequenceGGGGGCACGGGCAGCTTGCCGG
-
SpeciesSynthetic
-
MutationThree regions of SpCas9 encode type IIS restriction enzyme cassettes around D1135/S1136, G1218/E1219, R1335/T1337
- Promoter Dual T7
-
Tag
/ Fusion Protein
- NLS(SV40)-3xFLAG (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACYC-Duet-Up1-GGATCTCGACGCTCTCCCTT
- 3′ sequencing primer ACYC-Duet-Down1-GATTATGCGGCCGTGTACAA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACYC-T7-SpCas9(BspMI/SapI/BsaI_cassettes)-T7-gRNA1 (BPK1807) was a gift from Benjamin Kleinstiver (Addgene plasmid # 223065 ; http://n2t.net/addgene:223065 ; RRID:Addgene_223065) -
For your References section:
Custom CRISPR-Cas9 PAM variants via scalable engineering and machine learning. Silverstein RA, Kim N, Kroell AS, Walton RT, Delano J, Butcher RM, Pacesa M, Smith BK, Christie KA, Ha LL, Meis RJ, Clark AB, Spinner AD, Lazzarotto CR, Li Y, Matsubara A, Urbina EO, Dahl GA, Correia BE, Marks DS, Tsai SQ, Pinello L, De Ravin SS, Liu Q, Kleinstiver BP. Nature. 2025 Apr 22. doi: 10.1038/s41586-025-09021-y. 10.1038/s41586-025-09021-y PubMed 40262634