Skip to main content

pACYC-T7-SpCas9(BspMI/SapI/BsaI_cassettes)-T7-gRNA1 (BPK1807)
(Plasmid #223065)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223065 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pACYC-T7-SpCas9-T7-gRNA1 (BPK848)
  • Backbone manufacturer
    Benjamin Kleinstiver, Addgene plasmid #181745
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    entry vector for human codon opt. bacterial expr. plasmid for SpCas9(6AA_NNS) library, with gRNA targeting EGFP site 1
  • Alt name
    BPK1807
  • gRNA/shRNA sequence
    GGGGGCACGGGCAGCTTGCCGG
  • Species
    Synthetic
  • Mutation
    Three regions of SpCas9 encode type IIS restriction enzyme cassettes around D1135/S1136, G1218/E1219, R1335/T1337
  • Promoter Dual T7
  • Tag / Fusion Protein
    • NLS(SV40)-3xFLAG (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACYC-Duet-Up1-GGATCTCGACGCTCTCCCTT
  • 3′ sequencing primer ACYC-Duet-Down1-GATTATGCGGCCGTGTACAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACYC-T7-SpCas9(BspMI/SapI/BsaI_cassettes)-T7-gRNA1 (BPK1807) was a gift from Benjamin Kleinstiver (Addgene plasmid # 223065 ; http://n2t.net/addgene:223065 ; RRID:Addgene_223065)
  • For your References section:

    Custom CRISPR-Cas9 PAM variants via scalable engineering and machine learning. Silverstein RA, Kim N, Kroell AS, Walton RT, Delano J, Butcher RM, Pacesa M, Smith BK, Christie KA, Ha LL, Meis RJ, Clark AB, Spinner AD, Lazzarotto CR, Li Y, Matsubara A, Urbina EO, Dahl GA, Correia BE, Marks DS, Tsai SQ, Pinello L, De Ravin SS, Liu Q, Kleinstiver BP. Nature. 2025 Apr 22. doi: 10.1038/s41586-025-09021-y. 10.1038/s41586-025-09021-y PubMed 40262634