pICH86966::AtU6p::sgRNA:NbCysP6
(Plasmid
#223217)
-
PurposeExpresses an sgRNA targeting the NbCysP6 gene in Nicotiana benthamiana with an Arabidopsis U6 promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 223217 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepICH86966::AtU6p::sgRNA_PDS (Plasmid #46966)
-
Backbone manufacturerProfessor Sophien Kamoun
- Backbone size w/o insert (bp) 6530
- Total vector size (bp) 6550
-
Modifications to backboneCloned the NbCysP6 sgRNA sequence (5' - GAGGAAGACTACCCTTACAC - 3') sequence into the pICH86966::AtU6p::sgRNA_PDS (Plasmid #46966) using CPEC
-
Vector typePlant Expression, CRISPR, Synthetic Biology
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Growth instructionsOnce cloned into DH5a, transform into Agrobacterium AGL for Agroinfiltration
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNbCysP6 sgRNA
-
Alt nameKX375796.1 Nicotiana benthamiana papain-like cysteine proteinase 6 or AQQ13385.1
-
gRNA/shRNA sequenceGAGGAAGACTACCCTTACAC
-
SpeciesNicotiana benthamiana
-
GenBank IDKX375796.1
- Promoter Arabidopsis U6 promoter
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Other
- 5′ sequencing primer TTCTGAGCGGGTCTGGATCT
- 3′ sequencing primer CGGTCACATGTGCATCCTCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pICH86966::AtU6p::sgRNA:NbCysP6 was a gift from Tsepo Tsekoa (Addgene plasmid # 223217 ; http://n2t.net/addgene:223217 ; RRID:Addgene_223217) -
For your References section:
Transient proteolysis reduction of Nicotiana benthamiana-produced CAP256 broadly neutralizing antibodies using CRISPR/Cas9. Singh AA, Pillay P, Naicker P, Alexandre K, Malatji K, Mach L, Steinkellner H, Vorster J, Chikwamba R, Tsekoa TL. Front Plant Sci. 2022 Aug 18;13:953654. doi: 10.3389/fpls.2022.953654. eCollection 2022. 10.3389/fpls.2022.953654 PubMed 36061808