Skip to main content
Addgene

pICH86966::AtU6p::sgRNA:NbVPE1a/b
(Plasmid #223218)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223218 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pICH86966::AtU6p::sgRNA_PDS (Plasmid #46966)
  • Backbone manufacturer
    Professor Sophien Kamoun
  • Backbone size w/o insert (bp) 6530
  • Total vector size (bp) 6550
  • Modifications to backbone
    Using CPEC, the sgRNA targeting both NbVPE1a and NbVPE1b was cloned into the pICH86966::AtU6p::sgRNA_PDS (Plasmid #46966) vector
  • Vector type
    Plant Expression, CRISPR, Synthetic Biology
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Growth instructions
    Once cloned into DH5a, transform into Agrobacterium AGL if Agroinfiltration is the next step.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NbVPE1a/b
  • Alt name
    AB181187.1 Nicotiana benthamiana NbVPE-1a mRNA for vacuolar processing enzyme 1a, partial cds
  • Alt name
    AB181188.1 Nicotiana benthamiana NbVPE-1b mRNA for vacuolar processing enzyme 1b, partial cd.
  • gRNA/shRNA sequence
    TCAAAGAGAGAACTGCTACT
  • Species
    Nicotiana benthamiana
  • GenBank ID
    AB181187.1 AB181188.1
  • Promoter Arabidopsis U6 promoter
  • Tag / Fusion Protein
    • None

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer TTCTGAGCGGGTCTGGATCT
  • 3′ sequencing primer CGGTCACATGTGCATCCTCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pICH86966::AtU6p::sgRNA:NbVPE1a/b was a gift from Tsepo Tsekoa (Addgene plasmid # 223218 ; http://n2t.net/addgene:223218 ; RRID:Addgene_223218)
  • For your References section:

    Transient proteolysis reduction of Nicotiana benthamiana-produced CAP256 broadly neutralizing antibodies using CRISPR/Cas9. Singh AA, Pillay P, Naicker P, Alexandre K, Malatji K, Mach L, Steinkellner H, Vorster J, Chikwamba R, Tsekoa TL. Front Plant Sci. 2022 Aug 18;13:953654. doi: 10.3389/fpls.2022.953654. eCollection 2022. 10.3389/fpls.2022.953654 PubMed 36061808