Skip to main content

pAAV-U6-sgPet-1-hSyn-mCherry-KASH
(Plasmid #223227)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223227 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-U6-sgRNA-hSyn-mCherry-KASH
  • Backbone size w/o insert (bp) 5270
  • Total vector size (bp) 5294
  • Modifications to backbone
    Destroyed SapI digestion site
  • Vector type
    Mammalian Expression, Mouse Targeting, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Fev
  • Alt name
    Pet-1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    24
  • GenBank ID
  • Entrez Gene
    Fev (a.k.a. Pet-1, Pet1, Pex1, mPet-1)
  • Promoter U6
  • Tag / Fusion Protein
    • mCherry

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

gRNA target sequence: GCCGCGCCACCTCGTCCGGGTCGG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-U6-sgPet-1-hSyn-mCherry-KASH was a gift from Kyungjin Kim (Addgene plasmid # 223227 ; http://n2t.net/addgene:223227 ; RRID:Addgene_223227)
  • For your References section:

    Role of the circadian nuclear receptor REV-ERBalpha in dorsal raphe serotonin synthesis in mood regulation. Park I, Choi M, Kim J, Jang S, Kim D, Kim J, Choe Y, Geum D, Yu SW, Choi JW, Moon C, Choe HK, Son GH, Kim K. Commun Biol. 2024 Aug 15;7(1):998. doi: 10.1038/s42003-024-06647-y. 10.1038/s42003-024-06647-y PubMed 39147805