CMV_Mex3a_mutRING_t2a_mCherry
(Plasmid
#223245)
-
PurposeExpression of mutant RING Mex3a in mammalian cells with t2a cleaved mCherry
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 223245 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTRE2
- Total vector size (bp) 5777
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMex3a
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1560
-
Mutation4 point mutations in RING Domain: Cys 484 Ala; His 486 Ala; Cys 490 Ala; Cys 493 Ala
-
Entrez GeneMex3a (a.k.a. 2700083E18Rik, Gm411, Rkhd4)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer TGGAGACGCCATCCACGCTG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note, this mutantRING version of Mex3a preserves mus musculus amino acids for Mex3a (except the four amino acids of RING domain's cross brace structure), but changes the underlying DNA sequence to reduce CG content.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV_Mex3a_mutRING_t2a_mCherry was a gift from Stavros Lomvardas (Addgene plasmid # 223245 ; http://n2t.net/addgene:223245 ; RRID:Addgene_223245)