pTrc-clbS_Gibsiella
              
              
                (Plasmid
                
                #223356)
              
            
            
            
          - 
            PurposeEncoding ClbS from Gibbsiella quercinecans DSM 25889
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 223356 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepTrcHis 2A
 - 
              Backbone manufacturerThermofisher scientific
 - Backbone size w/o insert (bp) 4257
 - Total vector size (bp) 4770
 - 
              Vector typeBacterial Expression
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)NEB Stable
 - 
            Copy numberLow Copy
 
Gene/Insert
- 
                Gene/Insert nameEncoding ClbS from Gibbsiella quercinecans DSM 25889 (Codon optimized for E coli)
 - 
                    SpeciesGibbsiella quercinecans DSM 25889
 - 
                  Insert Size (bp)516
 - Promoter pTrc
 
Cloning Information
- Cloning method Gibson Cloning
 - 5′ sequencing primer GAGAAAAAGCGAAGCGGCACTGCT
 - 3′ sequencing primer GCATGGGGTCAGGTGGGACC (Common Sequencing Primers)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pTrc-clbS_Gibsiella was a gift from Emily Balskus (Addgene plasmid # 223356 ; http://n2t.net/addgene:223356 ; RRID:Addgene_223356) - 
                
For your References section:
The bacterial toxin colibactin triggers prophage induction. Silpe JE, Wong JWH, Owen SV, Baym M, Balskus EP. Nature. 2022 Mar;603(7900):315-320. doi: 10.1038/s41586-022-04444-3. Epub 2022 Feb 23. 10.1038/s41586-022-04444-3 PubMed 35197633