Skip to main content
Addgene

macroH2A1.2-F192V-GFP (pc5115)
(Plasmid #223438)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223438 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    macroH2A.2-GFP(pc 2189)
  • Backbone manufacturer
    Addgene #223708
  • Backbone size w/o insert (bp) 4733
  • Total vector size (bp) 5843
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    macroH2A1.2-F192V
  • Alt name
    macroH2A1
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1113
  • Mutation
    Mutation of phenylalanine 192 to valine (F192V)
  • Entrez Gene
    Macroh2a1 (a.k.a. H2A.y, H2A/y, H2afy, mH2A1)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (C terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GGTGCAGATGAACTTCAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Provided by Emily Bernstein Department of Oncological Sciences & Dermatology, Mount Sinai School of Medicine, One Gustave L. Levy Place, Box 1130, New York, NY 10029

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    macroH2A1.2-F192V-GFP (pc5115) was a gift from Cristina Cardoso (Addgene plasmid # 223438 ; http://n2t.net/addgene:223438 ; RRID:Addgene_223438)
  • For your References section:

    Histone variant macroH2A1 regulates synchronous firing of replication origins in the inactive X chromosome. Arroyo M, Casas-Delucchi CS, Pabba MK, Prorok P, Pradhan SK, Rausch C, Lehmkuhl A, Maiser A, Buschbeck M, Pasque V, Bernstein E, Luck K, Cardoso MC. Nucleic Acids Res. 2024 Aug 27:gkae734. doi: 10.1093/nar/gkae734. 10.1093/nar/gkae734 PubMed 39189450