macroH2A2-V192F-GFP (pc5116)
(Plasmid
#223439)
-
PurposeMutation of valine 192 to phenylalanine (V192F) in macroH2A2.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 223439 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonemacroH2A2-GFP(pc 2188)
-
Backbone manufacturerAddgene #223709
- Backbone size w/o insert (bp) 4733
- Total vector size (bp) 5843
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GGTGCAGATGAACTTCAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byProvided by Emily Bernstein Department of Oncological Sciences & Dermatology, Mount Sinai School of Medicine, One Gustave L. Levy Place, Box 1130, New York, NY 10029
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
macroH2A2-V192F-GFP (pc5116) was a gift from Cristina Cardoso (Addgene plasmid # 223439 ; http://n2t.net/addgene:223439 ; RRID:Addgene_223439) -
For your References section:
Histone variant macroH2A1 regulates synchronous firing of replication origins in the inactive X chromosome. Arroyo M, Casas-Delucchi CS, Pabba MK, Prorok P, Pradhan SK, Rausch C, Lehmkuhl A, Maiser A, Buschbeck M, Pasque V, Bernstein E, Luck K, Cardoso MC. Nucleic Acids Res. 2024 Aug 27:gkae734. doi: 10.1093/nar/gkae734. 10.1093/nar/gkae734 PubMed 39189450