pDUP2
(Plasmid
#223517)
-
Purposecogfp copy 1 under control of Ptet, cogfp copy 2 under control of Ptac
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 223517 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEXT20
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameCoGFP
-
SpeciesCavernularia obesa
-
Insert Size (bp)690
-
Mutationanti-dimerization mutations S129G, 22 C154S, D156G, K204I, and N209Y
- Promoter Ptet
-
Tag
/ Fusion Protein
- His tag (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer GAGTTGTAAAACGACGGCCAG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCoGFP (second copy)
-
SpeciesCavernularia obesa
-
Mutationanti-dimerization mutations S129G, 22 C154S, D156G, K204I, and N209Y
- Promoter Ptac
-
Tag
/ Fusion Protein
- His tag (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site NcoI (not destroyed)
- 5′ sequencing primer GCCGTCACTGCGTCTTTTAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
These plasmids contain repetitive genes, oriented facing each other, and therefore PCR and next generation sequencing may fail due to the special nature of the plasmids, however the function is not affected.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDUP2 was a gift from Yolanda Schaerli (Addgene plasmid # 223517 ; http://n2t.net/addgene:223517 ; RRID:Addgene_223517) -
For your References section:
A direct experimental test of Ohno’s hypothesis. Ljiljana Mihajlovic, Bharat Ravi Iyengar, Florian Baier, Içvara Barbier, Justyna Iwaszkiewicz, Vincent Zoete, Andreas Wagner, Yolanda Schaerli. eLife13:RP97216 10.7554/eLife.97216.1