Skip to main content

pDUP2
(Plasmid #223517)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223517 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEXT20
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    CoGFP
  • Species
    Cavernularia obesa
  • Insert Size (bp)
    690
  • Mutation
    anti-dimerization mutations S129G, 22 C154S, D156G, K204I, and N209Y
  • Promoter Ptet
  • Tag / Fusion Protein
    • His tag (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer GAGTTGTAAAACGACGGCCAG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    CoGFP (second copy)
  • Species
    Cavernularia obesa
  • Mutation
    anti-dimerization mutations S129G, 22 C154S, D156G, K204I, and N209Y
  • Promoter Ptac
  • Tag / Fusion Protein
    • His tag (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NcoI (not destroyed)
  • 5′ sequencing primer GCCGTCACTGCGTCTTTTAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

These plasmids contain repetitive genes, oriented facing each other, and therefore PCR and next generation sequencing may fail due to the special nature of the plasmids, however the function is not affected.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDUP2 was a gift from Yolanda Schaerli (Addgene plasmid # 223517 ; http://n2t.net/addgene:223517 ; RRID:Addgene_223517)
  • For your References section:

    A direct experimental test of Ohno’s hypothesis. Ljiljana Mihajlovic, Bharat Ravi Iyengar, Florian Baier, Içvara Barbier, Justyna Iwaszkiewicz, Vincent Zoete, Andreas Wagner, Yolanda Schaerli. eLife13:RP97216 10.7554/eLife.97216.1