Skip to main content

pTL51_cHS4-CAG-s36GFPHaloTag-IRES-PuroR-p2AmCherry3NLS-polyA-cHS4
(Plasmid #223542)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223542 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    YCe3736_HC_Amp_ccdB_receiver vector
  • Backbone size w/o insert (bp) 1842
  • Total vector size (bp) 10159
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    s36GFP-HaloTag, mCherry-3NLS, PAC
  • Insert Size (bp)
    8317
  • Promoter CAG

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer TCTTACGTGCCGATCAAGTC
  • 3′ sequencing primer GATCCGGCAAACAAACCACC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Supercharged GFP: custom synthesis by GeneArt based on Addgene plasmid 71758 purchased from Addgene. HaloTag: custom synthesis by Twist based on plasmid 72269 purchased from Addgene. mCherry-3NLS: in-house based on Addgene plasmid 176628 purchased from Addgene. PuroR: Addgene #183603. cHS4: Addgene #171499.

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTL51_cHS4-CAG-s36GFPHaloTag-IRES-PuroR-p2AmCherry3NLS-polyA-cHS4 was a gift from Sally Lowell (Addgene plasmid # 223542 ; http://n2t.net/addgene:223542 ; RRID:Addgene_223542)
  • For your References section:

    PUFFFIN: an ultra-bright, customisable, single-plasmid system for labelling cell neighbourhoods. Lebek T, Malaguti M, Boezio GL, Zoupi L, Briscoe J, Elfick A, Lowell S. EMBO J. 2024 Jul 12. doi: 10.1038/s44318-024-00154-w. 10.1038/s44318-024-00154-w PubMed 38997504