pTL52_pyCAG-s36GFPHaloTag-IRES-mCherry3NLS-polyA
(Plasmid
#223544)
-
PurposeMinimal PUFFHalo cassette with s36GFP-HaloTag and mCherry-3NLS, strong constitutive promoter CAG, no insulation or mammalian selection gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 223544 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneYCe3736_HC_Amp_ccdB_receiver vector
- Backbone size w/o insert (bp) 1842
- Total vector size (bp) 7585
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert names36GFP-HaloTag, mCherry-3NLS
-
Insert Size (bp)5743
- Promoter CAG
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer TCTTACGTGCCGATCAAGTC
- 3′ sequencing primer GATCCGGCAAACAAACCACC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySupercharged GFP: custom synthesis by GeneArt based on Addgene plasmid 71758 purchased from Addgene. mCherry-3NLS: in-house based on Addgene plasmid 176628 purchased from Addgene. HaloTag: custom synthesis by Twist based on plasmid 72269 purchased from Addgene.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTL52_pyCAG-s36GFPHaloTag-IRES-mCherry3NLS-polyA was a gift from Sally Lowell (Addgene plasmid # 223544 ; http://n2t.net/addgene:223544 ; RRID:Addgene_223544) -
For your References section:
PUFFFIN: an ultra-bright, customisable, single-plasmid system for labelling cell neighbourhoods. Lebek T, Malaguti M, Boezio GL, Zoupi L, Briscoe J, Elfick A, Lowell S. EMBO J. 2024 Jul 12. doi: 10.1038/s44318-024-00154-w. 10.1038/s44318-024-00154-w PubMed 38997504