pLenti6_cppt-CMV-Puffling-opre
(Plasmid #223547)

• Purpose: Minimal PUFFFIN cassette with s36GFP-mNeonGreen and mCherry-3NLS, separated by t2A self-cleaving peptide, strong constitutive promoter CMV, for lentivirus
• Depositing Lab: Sally Lowell
• Publication: Lebek et al EMBO J. 2024 Jul 12. doi: 10.1038/s44318-024-00154-w.

Backbone

• Vector backbone: pLenti6.2
• Backbone size w/o insert (bp): 7834
• Total vector size (bp): 10240
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: s36GFP-mNeonGreen, mCherry-3NLS
• Insert Size (bp): 2406
• Promoter: CMV

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Resource Information

• Supplemental Documents:
  • pLenti6_cppt-CMV-Puffling-opre.gb
• A portion of this plasmid was derived from a plasmid made by: Supercharged GFP: custom synthesis by GeneArt based on Addgene plasmid 71758 purchased from Addgene. mNeonGreen: custom synthesis by GeneArt based on Addgene plasmid 231090 purchased from Addgene. mCherry-3NLS: in-house based on Addgene plasmid 176628 purchased from Addgene. PuroR: Addgene #183603. cHS4: Addgene #171499.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry