Skip to main content

His-PHD2-181-426
(Plasmid #223551)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223551 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pProEx-HTa
  • Backbone size w/o insert (bp) 4745
  • Total vector size (bp) 5489
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PHD2
  • Alt name
    EGLN1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    741
  • Mutation
    Deleted amino acids 1-180.
  • Entrez Gene
    EGLN1 (a.k.a. C1orf12, ECYT3, HALAH, HIF-PH2, HIFPH2, HPH-2, HPH2, PHD2, SM20, ZMYND6)
  • Promoter trc
  • Tag / Fusion Protein
    • 6x His (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer AGCGGATAACAATTTCACACAGG
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    His-PHD2-181-426 was a gift from Somshuvra Mukhopadhyay (Addgene plasmid # 223551 ; http://n2t.net/addgene:223551 ; RRID:Addgene_223551)
  • For your References section:

    PHD2 enzyme is an intracellular manganese sensor that initiates the homeostatic response against elevated manganese. Gurol KC, Jursa T, Cho EJ, Fast W, Dalby KN, Smith DR, Mukhopadhyay S. Proc Natl Acad Sci U S A. 2024 Jun 25;121(26):e2402538121. doi: 10.1073/pnas.2402538121. Epub 2024 Jun 21. 10.1073/pnas.2402538121 PubMed 38905240