His-PHD2-181-426
(Plasmid
#223551)
-
PurposeHis-tagged human PHD2 catalytic domain with TEV cleavage site between His and PHD2 for PHD2 purification
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 223551 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepProEx-HTa
- Backbone size w/o insert (bp) 4745
- Total vector size (bp) 5489
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePHD2
-
Alt nameEGLN1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)741
-
MutationDeleted amino acids 1-180.
-
Entrez GeneEGLN1 (a.k.a. C1orf12, ECYT3, HALAH, HIF-PH2, HIFPH2, HPH-2, HPH2, PHD2, SM20, ZMYND6)
- Promoter trc
-
Tag
/ Fusion Protein
- 6x His (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AGCGGATAACAATTTCACACAGG
- 3′ sequencing primer GATTTAATCTGTATCAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
His-PHD2-181-426 was a gift from Somshuvra Mukhopadhyay (Addgene plasmid # 223551 ; http://n2t.net/addgene:223551 ; RRID:Addgene_223551) -
For your References section:
PHD2 enzyme is an intracellular manganese sensor that initiates the homeostatic response against elevated manganese. Gurol KC, Jursa T, Cho EJ, Fast W, Dalby KN, Smith DR, Mukhopadhyay S. Proc Natl Acad Sci U S A. 2024 Jun 25;121(26):e2402538121. doi: 10.1073/pnas.2402538121. Epub 2024 Jun 21. 10.1073/pnas.2402538121 PubMed 38905240