Skip to main content

pHR-CD80-mGFP
(Plasmid #223591)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223591 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHR
  • Vector type
    Lentiviral ; Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD80
  • Species
    H. sapiens (human)
  • Entrez Gene
    CD80 (a.k.a. B7, B7-1, B7.1, BB1, CD28LG, CD28LG1, LAB7)
  • Tag / Fusion Protein
    • mGFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ccaatcagcctgcttctcgcttc
  • 3′ sequencing primer ccagaggttgattatcgataagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid lab code: L700

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-CD80-mGFP was a gift from Enfu Hui (Addgene plasmid # 223591 ; http://n2t.net/addgene:223591 ; RRID:Addgene_223591)
  • For your References section:

    PD-L1:CD80 Cis-Heterodimer Triggers the Co-stimulatory Receptor CD28 While Repressing the Inhibitory PD-1 and CTLA-4 Pathways. Zhao Y, Lee CK, Lin CH, Gassen RB, Xu X, Huang Z, Xiao C, Bonorino C, Lu LF, Bui JD, Hui E. Immunity. 2019 Dec 17;51(6):1059-1073.e9. doi: 10.1016/j.immuni.2019.11.003. Epub 2019 Nov 19. 10.1016/j.immuni.2019.11.003 PubMed 31757674