pHR-CD80-mGFP
(Plasmid
#223591)
-
PurposeLentiviral expression of human CD80 with mGFP tag in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 223591 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR
-
Vector typeLentiviral ; Mammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCD80
-
SpeciesH. sapiens (human)
-
Entrez GeneCD80 (a.k.a. B7, B7-1, B7.1, BB1, CD28LG, CD28LG1, LAB7)
-
Tag
/ Fusion Protein
- mGFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ccaatcagcctgcttctcgcttc
- 3′ sequencing primer ccagaggttgattatcgataagc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid lab code: L700
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-CD80-mGFP was a gift from Enfu Hui (Addgene plasmid # 223591 ; http://n2t.net/addgene:223591 ; RRID:Addgene_223591) -
For your References section:
PD-L1:CD80 Cis-Heterodimer Triggers the Co-stimulatory Receptor CD28 While Repressing the Inhibitory PD-1 and CTLA-4 Pathways. Zhao Y, Lee CK, Lin CH, Gassen RB, Xu X, Huang Z, Xiao C, Bonorino C, Lu LF, Bui JD, Hui E. Immunity. 2019 Dec 17;51(6):1059-1073.e9. doi: 10.1016/j.immuni.2019.11.003. Epub 2019 Nov 19. 10.1016/j.immuni.2019.11.003 PubMed 31757674