Skip to main content
Addgene

pNHA14
(Plasmid #223646)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 223646 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pUC18.1rp
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    mxiE
  • Entrez Gene
    mxiE (a.k.a. D742_p5051)
  • Promoter rpsM

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer caggaaacagctatgaccatg
  • 3′ sequencing primer tgtaaaacgacggccagt
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    turboID
  • Species
    Synthetic
  • Promoter rpsM
  • Tag / Fusion Protein
    • Myc (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer caggaaacagctatgaccatg
  • 3′ sequencing primer tgtaaaacgacggccagt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNHA14 was a gift from François-Xavier Campbell-Valois (Addgene plasmid # 223646 ; http://n2t.net/addgene:223646 ; RRID:Addgene_223646)
  • For your References section:

    The promiscuous biotin ligase TurboID reveals the proxisome of the T3SS chaperone IpgC in Shigella flexneri. Haidar-Ahmad N, Tomaro K, Lavallee-Adam M, Campbell-Valois F-X. mSphere. 2024 Nov 21;9(11):e0055324. doi: 10.1128/msphere.00553-24. Epub 2024 Oct 31. 10.1128/msphere.00553-24 PubMed 39480076