PB-GFP11x7-HygR
(Plasmid
#223676)
-
PurposeTo check the split GFP signals in mitochondria (2)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 223676 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePiggyBac
- Total vector size (bp) 8292
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP11x7
-
Alt nameGFP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)887
-
GenBank ID
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP11 (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-GFP11x7-HygR was a gift from Juan Melero-Martin (Addgene plasmid # 223676 ; http://n2t.net/addgene:223676 ; RRID:Addgene_223676) -
For your References section:
Mitochondrial transfer mediates endothelial cell engraftment through mitophagy. Lin RZ, Im GB, Luo AC, Zhu Y, Hong X, Neumeyer J, Tang HW, Perrimon N, Melero-Martin JM. Nature. 2024 May;629(8012):660-668. doi: 10.1038/s41586-024-07340-0. Epub 2024 May 1. 10.1038/s41586-024-07340-0 PubMed 38693258