Ntom-Venus-ssrA
(Plasmid
#223688)
-
PurposePhoBIT1 component; Venus-tagged ssrA tag fused with Ntom for mitochondrial tethering
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 223688 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTriEX
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namessrA peptide
-
SpeciesSynthetic
-
Insert Size (bp)21
- Promoter CMV
-
Tag
/ Fusion Protein
- mVenus
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Ntom-Venus-ssrA was a gift from Yubin Zhou (Addgene plasmid # 223688 ; http://n2t.net/addgene:223688 ; RRID:Addgene_223688) -
For your References section:
Engineering of photo-inducible binary interaction tools for biomedical applications. Lee YT, Guo L, Lan TH, Nonomura T, Liu G, Ma G, Wang R, Huang Y, Zhou Y. Nat Commun. 2025 Jul 28;16(1):6940. doi: 10.1038/s41467-025-61710-4. 10.1038/s41467-025-61710-4 PubMed 40721575