mCh-sspB(LOV2)
(Plasmid
#223689)
-
PurposePhoBIT1 component; mCherry-tagged sspB with LOV2 insertion
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 223689 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTriEX
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesspB(N)-LOV2-sspB(C)
-
SpeciesSynthetic
-
Insert Size (bp)777
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer CCCCGTAATGCAGAAGAAGA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCh-sspB(LOV2) was a gift from Yubin Zhou (Addgene plasmid # 223689 ; http://n2t.net/addgene:223689 ; RRID:Addgene_223689) -
For your References section:
Engineering of photo-inducible binary interaction tools for biomedical applications. Lee YT, Guo L, Lan TH, Nonomura T, Liu G, Ma G, Wang R, Huang Y, Zhou Y. Nat Commun. 2025 Jul 28;16(1):6940. doi: 10.1038/s41467-025-61710-4. 10.1038/s41467-025-61710-4 PubMed 40721575