STIM1ct-ssrA2-mCerulean
(Plasmid
#223690)
-
PurposePhoBIT2 component; ssrA2 tag (ssrA mutant A2C) inserted into mCerulean-tagged STIM1 cytoplasmic domain
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 223690 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonemCerulean-N1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSTIM1(233-685)-ssrA2
-
SpeciesH. sapiens (human)
-
Entrez GeneSTIM1 (a.k.a. D11S4896E, GOK, IMD10, STRMK, TAM, TAM1)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCerulean (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
STIM1ct-ssrA2-mCerulean was a gift from Yubin Zhou (Addgene plasmid # 223690 ; http://n2t.net/addgene:223690 ; RRID:Addgene_223690) -
For your References section:
Engineering of photo-inducible binary interaction tools for biomedical applications. Lee YT, Guo L, Lan TH, Nonomura T, Liu G, Ma G, Wang R, Huang Y, Zhou Y. Nat Commun. 2025 Jul 28;16(1):6940. doi: 10.1038/s41467-025-61710-4. 10.1038/s41467-025-61710-4 PubMed 40721575