Skip to main content
Addgene

STIM1ct-ssrA2-mCerulean
(Plasmid #223690)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223690 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    mCerulean-N1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    STIM1(233-685)-ssrA2
  • Species
    H. sapiens (human)
  • Entrez Gene
    STIM1 (a.k.a. D11S4896E, GOK, IMD10, STRMK, TAM, TAM1)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCerulean (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    STIM1ct-ssrA2-mCerulean was a gift from Yubin Zhou (Addgene plasmid # 223690 ; http://n2t.net/addgene:223690 ; RRID:Addgene_223690)
  • For your References section:

    Engineering of photo-inducible binary interaction tools for biomedical applications. Lee YT, Guo L, Lan TH, Nonomura T, Liu G, Ma G, Wang R, Huang Y, Zhou Y. Nat Commun. 2025 Jul 28;16(1):6940. doi: 10.1038/s41467-025-61710-4. 10.1038/s41467-025-61710-4 PubMed 40721575